The targeted metagenomics sequencing package utilises a 2-step PCR library preparation approach to amplify your choice of 16S, 18S or ITS regions and incorporate unique dual indexes and Illumina adapters into the library for sequencing. Samples are sequenced using the Illumina MiSeq instrument in the 300bp paired-end read mode to a guaranteed minimum of 40,000 read pairs per sample.
By using a 2-step PCR approach, the package can also be easily adapted for any amplicon with complimentary overhangs to undergo the 2nd index PCR step. Please consult our Genomics team for more information.
Our standard targeted metagenomics package includes:
- Sample entry QC
- Library preparation via 2-step PCR protocol
- Illumina 300bp PE sequencing, guaranteed >40,000 read pairs per sample
- Return of FastQ files via secure FTP or HDD
Optional extras:
- DNA Extraction
- Bioinformatics analysis
Custom Target
Samples for 2nd index PCR only should be prepared using primers with overhangs. Primers should be designed as below and resulting PCR product should form a discrete band on a gel with length of 450-550bp.
Forward primer: 5’ TCGTCGGCAGCGTCAGATGTGTATAAGAGACAG‐[locus-primer]
Reverse primer: 5’ GTCTCGTGGGCTCGGAGATGTGTATAAGAGACAG‐[locus-primer]
Samples will then undergo 2nd index PCR step and subsequent sequencing to 40,000 read pairs.
